Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 2169547
End position: 2169585
Length: 39

DNA sequence
>NC_014538, from 2169547 to 2169585 (39 bp); Thermoanaerobacter sp. X513 ACTGATGTAATCTTATGATGTAATCTACTGATGTAATCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2169157-2170221	Sequence	Thet_2204 - hypothetical protein (Protein is coded in complementary strand; from 2170221 to 2169157)