Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 2022352
End position: 2022387
Length: 36

DNA sequence
>NC_014538, from 2022352 to 2022387 (36 bp); Thermoanaerobacter sp. X513 CTTCAGCTGGTGCTGCTGCTGGTGCTCCAGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2022138-2022515	Sequence	Thet_2058 - 50S ribosomal protein L7/L12 (Protein is coded in complementary strand; from 2022515 to 2022138)