Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1986749
End position: 1986776
Length: 28

DNA sequence
>NC_014538, from 1986749 to 1986776 (28 bp); Thermoanaerobacter sp. X513 CAGAAGTCAGATGTCGGAAGTCAGATGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
1985081-1988376	Sequence	Thet_R0064 23S ribosomal RNA (Protein is coded in complementary strand; from 1988376 to 1985081)