Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1908859
End position: 1908882
Length: 24

DNA sequence
>NC_014538, from 1908859 to 1908882 (24 bp); Thermoanaerobacter sp. X513 TTCCATTTTTCCATTTTTCCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1903504-1912167	Sequence	Thet_1935 - glycosyltransferase 36 (Protein is coded in complementary strand; from 1912167 to 1903504)