Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1826647
End position: 1826670
Length: 24

DNA sequence
>NC_014538, from 1826647 to 1826670 (24 bp); Thermoanaerobacter sp. X513 TTCTTCTGTACTTCTGTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1826490-1828475	Sequence	Thet_1863 - excinuclease ABC subunit B (Protein is coded in complementary strand; from 1828475 to 1826490)