Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1683492
End position: 1683515
Length: 24

DNA sequence
>NC_014538, from 1683492 to 1683515 (24 bp); Thermoanaerobacter sp. X513 TTATTTCTATTTTTCTTTATATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1682775-1686212	Sequence	Thet_1718 - DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 1686212 to 1682775)