Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1536877
End position: 1536901
Length: 25

DNA sequence
>NC_014538, from 1536877 to 1536901 (25 bp); Thermoanaerobacter sp. X513 AAACAAAATAAAAAACAACAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1534896-1536962	Sequence	Thet_1565 - 7TM receptor with intracellular metal dependent phosphohydrolase (Protein is coded in complementary strand; from 1536962 to 1534896)