Sequence retrieval

Genome: Thermoanaerobacter sp. X513
Start position: 1351956
End position: 1351979
Length: 24

DNA sequence
>NC_014538, from 1351956 to 1351979 (24 bp); Thermoanaerobacter sp. X513 TTATTATTCTTATTATTATTCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1351938-1352537	Sequence	Thet_1364 - hypothetical protein (Protein is coded in complementary strand; from 1352537 to 1351938)