Sequence retrieval

Genome: Methanoplanus petrolearius DSM 11571
Start position: 1721739
End position: 1721771
Length: 33

DNA sequence
>NC_014507, from 1721739 to 1721771 (33 bp); Methanoplanus petrolearius DSM 11571 GCTGCTGCAAACCGGCTGCAAAGTTGCTGCAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1721236-1724163	Sequence	Mpet_1683 - hypothetical protein (Protein is coded in complementary strand; from 1724163 to 1721236)