Sequence retrieval

Genome: Methanoplanus petrolearius DSM 11571
Start position: 561965
End position: 561994
Length: 30

DNA sequence
>NC_014507, from 561965 to 561994 (30 bp); Methanoplanus petrolearius DSM 11571 GGCATATATCCGAATATATCGGCATAGATA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 561611-562768	Sequence	Mpet_0558 - iron-containing alcohol dehydrogenase