Sequence retrieval

Genome: Methanoplanus petrolearius DSM 11571
Start position: 1292985
End position: 1293014
Length: 30

DNA sequence
>NC_014507, from 1292985 to 1293014 (30 bp); Methanoplanus petrolearius DSM 11571 AAAAAAGATCAAAAAAGTCCAAAAAAAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1293014-1294030	Sequence	Mpet_1260 - coenzyme F420 hydrogenase (Protein is coded in complementary strand; from 1294030 to 1293014)