Sequence retrieval

Genome: Methanoplanus petrolearius DSM 11571
Start position: 1128476
End position: 1128505
Length: 30

DNA sequence
>NC_014507, from 1128476 to 1128505 (30 bp); Methanoplanus petrolearius DSM 11571 ATTCTAAGATATTCCCAGATCTTCTCAGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1128419-1131247	Sequence	Mpet_1107 - putative PAS/PAC sensor protein (Protein is coded in complementary strand; from 1131247 to 1128419)