Sequence retrieval

Genome: Methanoplanus petrolearius DSM 11571
Start position: 2467890
End position: 2467916
Length: 27

DNA sequence
>NC_014507, from 2467890 to 2467916 (27 bp); Methanoplanus petrolearius DSM 11571 TTCAGGTGGTTGAGGTGGTTGAGGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2467185-2468897	Sequence	Mpet_2467 - formylmethanofuran dehydrogenase subunit A (Protein is coded in complementary strand; from 2468897 to 2467185)