Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 783174
End position: 783197
Length: 24

DNA sequence
>NC_014484, from 783174 to 783197 (24 bp); Spirochaeta thermophila DSM 6192 TCACCCCCACCCCCACCCCCACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 782444-783235	Sequence	STHERM_c07000 - hypothetical protein (Protein is coded in complementary strand; from 783235 to 782444)