Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 718206
End position: 718229
Length: 24

DNA sequence
>NC_014484, from 718206 to 718229 (24 bp); Spirochaeta thermophila DSM 6192 GGGGGAGGGTGAGGGAGAGGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 716816-718405	Sequence	STHERM_c06360 - hypothetical protein (Protein is coded in complementary strand; from 718405 to 716816)