Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 673202
End position: 673225
Length: 24

DNA sequence
>NC_014484, from 673202 to 673225 (24 bp); Spirochaeta thermophila DSM 6192 CCTCCACCTCCTCCACCACCCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 672475-673650	Sequence	STHERM_c05940 - hypothetical protein (Protein is coded in complementary strand; from 673650 to 672475)