Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 619830
End position: 619853
Length: 24

DNA sequence
>NC_014484, from 619830 to 619853 (24 bp); Spirochaeta thermophila DSM 6192 GGAGGAGGGGGAGGAGGAGGCGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 618536-619927	Sequence	STHERM_c05360 phoR phosphate regulon sensor protein PhoR (Protein is coded in complementary strand; from 619927 to 618536)