Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 58249
End position: 58273
Length: 25

DNA sequence
>NC_014484, from 58249 to 58273 (25 bp); Spirochaeta thermophila DSM 6192 GGGGGTGGGGAGGGGGGGTGTGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 57429-58511	Sequence	STHERM_c00550 - hypothetical protein (Protein is coded in complementary strand; from 58511 to 57429)