Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 384736
End position: 384760
Length: 25

DNA sequence
>NC_014484, from 384736 to 384760 (25 bp); Spirochaeta thermophila DSM 6192 AGGGGTGGGGCGGGGAGGAGGGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 383235-385208	Sequence	STHERM_c03090 - hypothetical protein (Protein is coded in complementary strand; from 385208 to 383235)