Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 270932
End position: 270967
Length: 36

DNA sequence
>NC_014484, from 270932 to 270967 (36 bp); Spirochaeta thermophila DSM 6192 GGGGGTGGCGGAGGTGGTGCCGGAGGGGGTGGAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 270793-271479	Sequence	STHERM_c02130 - DNA / pantothenate metabolism flavoprotein