Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 261549
End position: 261584
Length: 36

DNA sequence
>NC_014484, from 261549 to 261584 (36 bp); Spirochaeta thermophila DSM 6192 GCGGGCGGAGGGGAGGGGGGAGGGGCGGGGGGTGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 260785-261846	Sequence	STHERM_c02040 - iron-sulfur protein (Protein is coded in complementary strand; from 261846 to 260785)