Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2339646
End position: 2339690
Length: 45

DNA sequence
>NC_014484, from 2339646 to 2339690 (45 bp); Spirochaeta thermophila DSM 6192 GGACGCCGGGGAGGGCGAGGCCGGGGATGGGGAAGACGGGGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2339291-2340136	Sequence	STHERM_c21200 - hypothetical protein (Protein is coded in complementary strand; from 2340136 to 2339291)