Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2281130
End position: 2281159
Length: 30

DNA sequence
>NC_014484, from 2281130 to 2281159 (30 bp); Spirochaeta thermophila DSM 6192 GGAGTGGGTGTGGGAGTCGGAGTAGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2280833-2283121	Sequence	STHERM_c20640 - glycoside hydrolase family 9, CBM3, linker, domain X (Protein is coded in complementary strand; from 2283121 to 2280833)