Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2278669
End position: 2278692
Length: 24

DNA sequence
>NC_014484, from 2278669 to 2278692 (24 bp); Spirochaeta thermophila DSM 6192 GGAGTCGGAGTAGGCGTCGGAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2278294-2280711	Sequence	STHERM_c20630 - glycoside hydrolase family 9, CBM3, linker, domain X (Protein is coded in complementary strand; from 2280711 to 2278294)