Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2277008
End position: 2277031
Length: 24

DNA sequence
>NC_014484, from 2277008 to 2277031 (24 bp); Spirochaeta thermophila DSM 6192 GTGGGCGTGGGTGTGGCCGTAGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2276600-2278225	Sequence	STHERM_c20620 - cellulase, glycosyl hydrolase family 5, TPS linker, domain X (Protein is coded in complementary strand; from 2278225 to 2276600)