Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2226072
End position: 2226096
Length: 25

DNA sequence
>NC_014484, from 2226072 to 2226096 (25 bp); Spirochaeta thermophila DSM 6192 CCCCTCCCCTCCCCACGCCTCCACT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2217952-2228562	Sequence	STHERM_c20200 - hypothetical protein (Protein is coded in complementary strand; from 2228562 to 2217952)