Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2202552
End position: 2202575
Length: 24

DNA sequence
>NC_014484, from 2202552 to 2202575 (24 bp); Spirochaeta thermophila DSM 6192 CCTCCTCCCCCTCCTCCCCCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2202077-2203114	Sequence	STHERM_c20030 - N-acetyl-gamma-glutamyl-phosphate reductase