Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2198248
End position: 2198283
Length: 36

DNA sequence
>NC_014484, from 2198248 to 2198283 (36 bp); Spirochaeta thermophila DSM 6192 CACCCCCTCCAGCACGCCCACCAGCACCTCCTCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2198039-2198779	Sequence	STHERM_c19990 - hypothetical protein (Protein is coded in complementary strand; from 2198779 to 2198039)