Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 2082363
End position: 2082386
Length: 24

DNA sequence
>NC_014484, from 2082363 to 2082386 (24 bp); Spirochaeta thermophila DSM 6192 GACGAGGAAGAGGACGGGGACGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2081779-2082432	Sequence	STHERM_c18970 - transcriptional regulatory protein