Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1954337
End position: 1954363
Length: 27

DNA sequence
>NC_014484, from 1954337 to 1954363 (27 bp); Spirochaeta thermophila DSM 6192 CCCTGCCCGCCCGGCCCGGCCTGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1952288-1954837	Sequence	STHERM_c17860 ftsK DNA translocase FtsK (Protein is coded in complementary strand; from 1954837 to 1952288)