Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1820241
End position: 1820264
Length: 24

DNA sequence
>NC_014484, from 1820241 to 1820264 (24 bp); Spirochaeta thermophila DSM 6192 CCTCCACCACCAGCTCCACCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1819187-1822423	Sequence	STHERM_c16510 luxQ autoinducer 2 sensor kinase/phosphatase LuxQ (Protein is coded in complementary strand; from 1822423 to 1819187)