Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1735769
End position: 1735798
Length: 30

DNA sequence
>NC_014484, from 1735769 to 1735798 (30 bp); Spirochaeta thermophila DSM 6192 GTGGGTGTCGGTGTGGGCGTGGGCGTGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1735547-1737481	Sequence	STHERM_c15830 - glycosyl hydrolases family 18 (Protein is coded in complementary strand; from 1737481 to 1735547)