Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1558723
End position: 1558746
Length: 24

DNA sequence
>NC_014484, from 1558723 to 1558746 (24 bp); Spirochaeta thermophila DSM 6192 AGGAGGAAGAGGAGGAAGAGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1558138-1559184	Sequence	STHERM_c14310 - hypothetical protein (Protein is coded in complementary strand; from 1559184 to 1558138)