Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1470691
End position: 1470720
Length: 30

DNA sequence
>NC_014484, from 1470691 to 1470720 (30 bp); Spirochaeta thermophila DSM 6192 CTCCCCCTCCACCTCCCGCTCCCCCTCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1470587-1471618	Sequence	STHERM_c13550 - hypothetical protein (Protein is coded in complementary strand; from 1471618 to 1470587)