Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1437618
End position: 1437662
Length: 45

DNA sequence
>NC_014484, from 1437618 to 1437662 (45 bp); Spirochaeta thermophila DSM 6192 AGGGAGAAGAAGATGAGGGAGAAGAAGATGAGGGAGAAGAAGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1437411-1437683	Sequence	STHERM_c13240 - hypothetical protein (Protein is coded in complementary strand; from 1437683 to 1437411)