Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1375917
End position: 1375940
Length: 24

DNA sequence
>NC_014484, from 1375917 to 1375940 (24 bp); Spirochaeta thermophila DSM 6192 CTCCTCCTCCACCGCCTCCTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1375654-1376058	Sequence	STHERM_c12620 clpS ATP-dependent Clp protease adaptor protein clpS (Protein is coded in complementary strand; from 1376058 to 1375654)