Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1265411
End position: 1265434
Length: 24

DNA sequence
>NC_014484, from 1265411 to 1265434 (24 bp); Spirochaeta thermophila DSM 6192 GAGGACGAGGGCGAGGTCGAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1264767-1266128	Sequence	STHERM_c11610 - hypothetical protein (Protein is coded in complementary strand; from 1266128 to 1264767)