Sequence retrieval

Genome: Spirochaeta thermophila DSM 6192
Start position: 1252320
End position: 1252343
Length: 24

DNA sequence
>NC_014484, from 1252320 to 1252343 (24 bp); Spirochaeta thermophila DSM 6192 CCCCCCGACCCACCGACCCCTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1251179-1252993	Sequence	STHERM_c11520 lepA GTP-binding protein lepA (Protein is coded in complementary strand; from 1252993 to 1251179)