Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 927933
End position: 927956
Length: 24

DNA sequence
>NC_014472, from 927933 to 927956 (24 bp); Flavobacteriales bacterium HTCC2170 GCTGGTGGTGGTGGTGGTGGTGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 927438-928157	Sequence	FB2170_03005 - TonB (Protein is coded in complementary strand; from 928157 to 927438)