Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 834774
End position: 834797
Length: 24

DNA sequence
>NC_014472, from 834774 to 834797 (24 bp); Flavobacteriales bacterium HTCC2170 AAACCCAAATCCAATCCCAAACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 834132-835565	Sequence	FB2170_02590 - hypothetical protein (Protein is coded in complementary strand; from 835565 to 834132)