Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 813248
End position: 813271
Length: 24

DNA sequence
>NC_014472, from 813248 to 813271 (24 bp); Flavobacteriales bacterium HTCC2170 TTTATCTTTAACTTTTTCATTATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 812954-813268	Sequence	FB2170_02465 - 50S ribosomal protein L24 (Protein is coded in complementary strand; from 813268 to 812954)