Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 611568
End position: 611591
Length: 24

DNA sequence
>NC_014472, from 611568 to 611591 (24 bp); Flavobacteriales bacterium HTCC2170 ATTCAAATTCAGATTCGAATTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 610892-611677	Sequence	FB2170_01532 - DNA-binding response regulator RprY (Protein is coded in complementary strand; from 611677 to 610892)