Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 592095
End position: 592124
Length: 30

DNA sequence
>NC_014472, from 592095 to 592124 (30 bp); Flavobacteriales bacterium HTCC2170 GGCATTTAAAGGGTTTTAAAGGGTTTTAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 589848-592100	Sequence	FB2170_01432 - putative alpha-1,2-mannosidase (Protein is coded in complementary strand; from 592100 to 589848)