Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 3862107
End position: 3862130
Length: 24

DNA sequence
>NC_014472, from 3862107 to 3862130 (24 bp); Flavobacteriales bacterium HTCC2170 CATTATCATTATCACTATCATCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3861476-3863437	Sequence	FB2170_16126 - VCBS protein (Protein is coded in complementary strand; from 3863437 to 3861476)