Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 3621370
End position: 3621394
Length: 25

DNA sequence
>NC_014472, from 3621370 to 3621394 (25 bp); Flavobacteriales bacterium HTCC2170 TTTTTTTCTTTTTTCATTTTTCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3620765-3622444	Sequence	FB2170_15033 - hypothetical protein (Protein is coded in complementary strand; from 3622444 to 3620765)