Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 3301900
End position: 3301924
Length: 25

DNA sequence
>NC_014472, from 3301900 to 3301924 (25 bp); Flavobacteriales bacterium HTCC2170 TTTTTATTTTTTTCTTTCTTTTTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3301882-3302004	Sequence	FB2170_13548 - hypothetical protein (Protein is coded in complementary strand; from 3302004 to 3301882)