Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 3265897
End position: 3265921
Length: 25

DNA sequence
>NC_014472, from 3265897 to 3265921 (25 bp); Flavobacteriales bacterium HTCC2170 GTATTGTCTTTTATTGAATTGTAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3265798-3266706	Sequence	FB2170_13351 - hypothetical protein (Protein is coded in complementary strand; from 3266706 to 3265798)