Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 3164481
End position: 3164505
Length: 25

DNA sequence
>NC_014472, from 3164481 to 3164505 (25 bp); Flavobacteriales bacterium HTCC2170 AAAAAGAAAAAAAACAAATAAATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3162762-3164516	Sequence	FB2170_12826 - putative TonB-dependent outer membrane exported protein (Protein is coded in complementary strand; from 3164516 to 3162762)