Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 2869541
End position: 2869570
Length: 30

DNA sequence
>NC_014472, from 2869541 to 2869570 (30 bp); Flavobacteriales bacterium HTCC2170 TTAAAAAGATTTAACCAGATTTAAAAACAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 2869100-2869555	Sequence	FB2170_11566 - cold shock protein DNA-binding protein