Sequence retrieval

Genome: Flavobacteriales bacterium HTCC2170
Start position: 2398811
End position: 2398834
Length: 24

DNA sequence
>NC_014472, from 2398811 to 2398834 (24 bp); Flavobacteriales bacterium HTCC2170 GCTTTTGGTTTTGTTTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2398734-2398874	Sequence	FB2170_09486 - hypothetical protein (Protein is coded in complementary strand; from 2398874 to 2398734)